
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dhcr24
- Ensembl ID:
- ENSDARG00000013236
- ZFIN ID:
- ZDB-GENE-041212-73
- Description:
- 24-dehydrocholesterol reductase [Source:RefSeq peptide;Acc:NP_001008645]
- Human Orthologue:
- DHCR24
- Human Description:
- 24-dehydrocholesterol reductase [Source:HGNC Symbol;Acc:2859]
- Mouse Orthologue:
- Dhcr24
- Mouse Description:
- 24-dehydrocholesterol reductase Gene [Source:MGI Symbol;Acc:MGI:1922004]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15847 | Nonsense | Available for shipment | Available now |
sa3089 | Nonsense | F2 line generated | During 2018 |
sa5668 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa15847
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125019 | Nonsense | 50 | 516 | 1 | 9 |
The following transcripts of ENSDARG00000013236 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 7351270)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7186663 GRCz11 20 7176542 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCGTGTGCCTGTTTCTCCTGCCCTTGTCCGTCGTGTTTGATGTRTACTA[T/A]CAYCTGCGCGCCTGGATCATCTTCAAGATGTGCTCCGCGCCCAAACAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3089
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125019 | Nonsense | 482 | 516 | 9 | 9 |
ENSDART00000125019 | Nonsense | 482 | 516 | 9 | 9 |
The following transcripts of ENSDARG00000013236 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 7324091)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7159484 GRCz11 20 7149363 - KASP Assay ID:
- 554-3402.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGATTCCAGATGTTGTATGCTGATGTATACATGGAACRCAAKGAATTCTG[G/A]GAGATGTTTGACGGCACTTTGTATCACAAACTCAGAGAGGAGCTCGGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5668
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125019 | Nonsense | 482 | 516 | 9 | 9 |
ENSDART00000125019 | Nonsense | 482 | 516 | 9 | 9 |
The following transcripts of ENSDARG00000013236 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 7324091)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 7159484 GRCz11 20 7149363 - KASP Assay ID:
- 554-3402.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGATTCCAGATGTTGTATGCTGATGTATACATGGAACRCAAKGAATTCTG[G/A]GAGATGTTTGACGGCACTTTGTATCACAAACTCAGAGAGGAGCTCGGCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: