zgc:56685

Ensembl ID:
ENSDARG00000013224
ZFIN ID:
ZDB-GENE-040426-1113
Description:
polyhomeotic-like 2 [Source:RefSeq peptide;Acc:NP_957496]
Human Orthologue:
PHC2
Human Description:
polyhomeotic homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:3183]
Mouse Orthologue:
Phc2
Mouse Description:
polyhomeotic-like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1860454]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20812 Essential Splice Site Available for shipment Available now
sa38579 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20812
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019706 Essential Splice Site 340 853 7 15
Genomic Location (Zv9):
Chromosome 6 (position 48113542)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48174194
GRCz11 6 48172953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACATGAGTCGTAATGTGTCCTCTTCACATCCCTTAATAGCACCAGG[T/C]AAGCTCATTTCACTTAAGTCACATTTGAAAAGGTCTGAATGTCACTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019706 Nonsense 717 853 14 15
Genomic Location (Zv9):
Chromosome 6 (position 48136208)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 48196860
GRCz11 6 48195619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTTGTGTCTTTTTCTATATCTTTCCAGCGGCTTTCTGTATCTCAG[C/T]AATCTCAGGGAGAATCTATATCATCACCTCTTCAGTCTCAGCCTAGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link