zeb1

Ensembl ID:
ENSDARG00000013207
ZFIN ID:
ZDB-GENE-010621-1
Description:
zinc finger E-box-binding homeobox 1 [Source:RefSeq peptide;Acc:NP_571784]
Human Orthologue:
ZEB1
Human Description:
zinc finger E-box binding homeobox 1 [Source:HGNC Symbol;Acc:11642]
Mouse Orthologue:
Zeb1
Mouse Description:
zinc finger E-box binding homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:1344313]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2635 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047724 Nonsense 573 1078 6 8
Genomic Location (Zv9):
Chromosome 12 (position 28329873)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26667482
GRCz11 12 26758842
KASP Assay ID:
554-2726.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAGATATCGGAGTCTGTCAGTCTTCCAGCAGAGGTGGTGAAAAAGTG[G/A]TTTGAGAAGATGCAGCTGGGACAGATCTCCATRGACCCTTCTTCACCTMA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link