si:dkey-231l1.4

Ensembl ID:
ENSDARG00000013174
ZFIN ID:
ZDB-GENE-060503-63
Description:
naked cuticle-like protein 3 [Source:RefSeq peptide;Acc:NP_001182544]
Human Orthologue:
NKD2
Human Description:
naked cuticle homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:17046]
Mouse Orthologue:
Nkd2
Mouse Description:
naked cuticle 2 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1919543]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23597 Nonsense Available for shipment Available now
sa36918 Nonsense Mutation detected in F1 DNA During 2018
sa12174 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051713   None 275 None 5
ENSDART00000136147 Nonsense 107 177 6 8
Genomic Location (Zv9):
Chromosome 19 (position 45537284)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44435506
GRCz11 19 44031079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGACATTAGGAAAAGGAGTGTAATGTGTCCATCCCGGATGAAAATCGT[C/T]AAGAGTGGATGATTACACTGTATGGTTTGGACAACAGTGGGAAAATAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051713 Nonsense 94 275 4 5
ENSDART00000136147   None 177 None 8
Genomic Location (Zv9):
Chromosome 19 (position 45540012)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44438234
GRCz11 19 44033807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATTACTATAATTATATGATGTTCTTCTTTCAGAGTACTGAACTCAGAT[C/T]AGTTGAGTGCTCCAGAGAGGAAGCAGTACTCTGTAGATGAAAACACCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051713 Nonsense 230 275 5 5
ENSDART00000136147   None 177 None 8
Genomic Location (Zv9):
Chromosome 19 (position 45542857)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44441079
GRCz11 19 44036652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCAGCAAACGCATGCGTGCCCGAGCCCGAGAAACTGCATCACCGTCC[A/T]GAAWCCCCCAAGACAGAGATTYAAACTGCGGGACGGCTCTTCAGCCTRCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link