zgc:55558

Ensembl ID:
ENSDARG00000013161
ZFIN ID:
ZDB-GENE-040426-740
Description:
hypothetical protein LOC393228 [Source:RefSeq peptide;Acc:NP_956552]
Human Orthologues:
HRAS, KRAS, NRAS
Human Descriptions:
neuroblastoma RAS viral (v-ras) oncogene homolog [Source:HGNC Symbol;Acc:7989]
v-Ha-ras Harvey rat sarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:5173]
v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog [Source:HGNC Symbol;Acc:6407]
Mouse Orthologues:
Hras1, Kras, Nras
Mouse Descriptions:
Harvey rat sarcoma virus oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:96224]
neuroblastoma ras oncogene Gene [Source:MGI Symbol;Acc:MGI:97376]
v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene [Source:MGI Symbol;Acc:MGI:96680]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7542 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013816 Missense 46 187 3 5
ENSDART00000100961 Missense 46 187 3 5

The following transcripts of ENSDARG00000013161 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 16290848)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16521067
GRCz11 3 16670867
KASP Assay ID:
554-4057.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTATATTTTTTGACCCATGCAGGATTCATACAGAAAGCAGGTTGTGA[T/G]TGATGGAGAGACKTGTTTGCTGGATATCCTGGACACTGCAGGTCAGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link