
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dhx16
- Ensembl ID:
- ENSDARG00000013150
- ZFIN ID:
- ZDB-GENE-030131-8589
- Description:
- DEAH (Asp-Glu-Ala-His) box polypeptide 16 [Source:RefSeq peptide;Acc:NP_956318]
- Human Orthologue:
- DHX16
- Human Description:
- DEAH (Asp-Glu-Ala-His) box polypeptide 16 [Source:HGNC Symbol;Acc:2739]
- Mouse Orthologue:
- Dhx16
- Mouse Description:
- DEAH (Asp-Glu-Ala-His) box polypeptide 16 Gene [Source:MGI Symbol;Acc:MGI:1916442]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35958 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa39062 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42595 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35958
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006288 | Essential Splice Site | None | 1054 | 1 | 21 |
- Genomic Location (Zv9):
- Chromosome 15 (position 34229739)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 35075515 GRCz11 15 34933484 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCGCATACATGTTGTTGTAAGAGAAAGCGTGTGGAGAGACAACTAAACG[T/A]AAGTTTAGCGTTTCCAGTGTTAATGTTTAAGTTTGTGAACCAGTATACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39062
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006288 | Essential Splice Site | 66 | 1054 | 2 | 21 |
- Genomic Location (Zv9):
- Chromosome 15 (position 34226780)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 35072556 GRCz11 15 34930525 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGACATTGATCAAAGAATCACAGCGTTTGCACATGAGTTGTACGACAAGG[T/A]ATGTTTTTTAAGGTCAATACACAGAATGTTAATGTAATACTTGAATTTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42595
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006288 | Nonsense | 364 | 1054 | 7 | 21 |
- Genomic Location (Zv9):
- Chromosome 15 (position 34220975)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 35066751 GRCz11 15 34924720 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGCCAGACAAGAGCGCGAACGGCGGATCAAGGAGGAGCAGGAGAGATAC[C/T]AGCTCATTTTAGAGGAAGAGGAGATGATCACCTTCGTCAGCACCGCAATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: