si:zfos-979f1.3

Ensembl ID:
ENSDARG00000013128
ZFIN ID:
ZDB-GENE-091204-402
Human Orthologue:
PDK1
Human Description:
pyruvate dehydrogenase kinase, isozyme 1 [Source:HGNC Symbol;Acc:8809]
Mouse Orthologue:
Pdk1
Mouse Description:
pyruvate dehydrogenase kinase, isoenzyme 1 Gene [Source:MGI Symbol;Acc:MGI:1926119]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21421 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020861 Essential Splice Site 226 405 6 11
Genomic Location (Zv9):
Chromosome 9 (position 3138012)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 3133484
GRCz11 9 3139504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCGGTATTATATGAACTCGCCCGAGCTAGTGTTGGAGGAATTTAATGG[T/C]AACTTCCTGCTGCACATTCACAAAAGGTCATAAACAGAGTTGAGAGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Erectile dysfunction: Pilot genome-wide association search identifies potential loci for risk of erectile dysfunction in type 1 diabetes using the DCCT/EDIC study cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link