
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
maf1
- Ensembl ID:
- ENSDARG00000013122
- ZFIN ID:
- ZDB-GENE-040426-2788
- Description:
- Repressor of RNA polymerase III transcription MAF1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6PGU2]
- Human Orthologue:
- MAF1
- Human Description:
- MAF1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24966]
- Mouse Orthologue:
- Maf1
- Mouse Description:
- MAF1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1916127]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12335 | Nonsense | Available for shipment | Available now |
sa16843 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12335
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006703 | Nonsense | 34 | 247 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 11 (position 25009243)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 23810479 GRCz11 11 24048336 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGTCTGTNNCACTGTTTTGATGTGTCTGCAGCATTGAGAGCTACTCCTG[T/A]AAGATGGCAGGTGAKGACAAGCAGATGTTCAAGCAGTTTTGTCAGGAGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16843
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000006703 | Nonsense | 56 | 247 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 11 (position 25009178)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 23810544 GRCz11 11 24048401 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- KGACAAGCAGATGTTCAAGCAGTTTTGTCAGGAGGGGCAACCGCATGTGT[T/A]GGAGGCTTTGTCTCCTCCACAGAGCTCTGGAATCAGCCCTAACAAGTAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: