
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hiat1a
- Ensembl ID:
- ENSDARG00000013117
- ZFIN ID:
- ZDB-GENE-030131-834
- Description:
- hippocampus abundant transcript 1a [Source:RefSeq peptide;Acc:NP_955878]
- Human Orthologues:
- HIATL1, HIATL2
- Human Descriptions:
- hippocampus abundant transcript-like 1 [Source:HGNC Symbol;Acc:23376]
- hippocampus abundant transcript-like 2 [Source:HGNC Symbol;Acc:23672]
- Mouse Orthologue:
- Hiatl1
- Mouse Description:
- hippocampus abundant transcript-like 1 Gene [Source:MGI Symbol;Acc:MGI:1913881]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19820 | Nonsense | Available for shipment | Available now |
sa25862 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19820
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012191 | Nonsense | 180 | 493 | 6 | 12 |
- Genomic Location (Zv9):
- Chromosome 2 (position 37390373)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 37687083 GRCz11 2 37669540 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGCCACATTCGCAGCCAGTCTGGTCACCAGTCCGGCGATCGGGGCGTA[T/A]CTGTCTGAGGTGTACGGAGACACTCTAGTGGTGATCCTCGCCACGGCTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25862
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000012191 | Essential Splice Site | 423 | 493 | 11 | 12 |
- Genomic Location (Zv9):
- Chromosome 2 (position 37380327)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 37677037 GRCz11 2 37659494 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGTCCAGAAAAGGGTGTCAAACCCAACATGGCCAATCCCACAGATGAGG[T/C]GAGGAATGTCATGCAGTTAGGAGTGCTAAAAATAAGATCAGGTCAACAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: