si:dkey-24n17.6

Ensembl ID:
ENSDARG00000013024
ZFIN ID:
ZDB-GENE-091113-7
Human Orthologue:
ERAP1
Human Description:
endoplasmic reticulum aminopeptidase 1 [Source:HGNC Symbol;Acc:18173]
Mouse Orthologue:
Erap1
Mouse Description:
endoplasmic reticulum aminopeptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1933403]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15064 Nonsense Available for shipment Available now
sa41570 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15064
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048874 Nonsense 289 931 5 19
ENSDART00000122146 Nonsense 259 872 6 20
ENSDART00000124804 Nonsense 255 901 4 19
ENSDART00000147031 Nonsense 290 933 4 18
Genomic Location (Zv9):
Chromosome 10 (position 2932043)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2877680
GRCz11 10 2904851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGCCGTCACAATGCTYGACTTTTATGATGAGTATTTTGACATCCCGTA[T/A]CCGCTTCCCAAACACGGTGAGTGYGAAAGTTATCAGCAGTGGTCAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048874 Nonsense 768 931 16 19
ENSDART00000122146 Nonsense 703 872 16 20
ENSDART00000124804 Nonsense 731 901 15 19
ENSDART00000147031 Nonsense 766 933 15 18
Genomic Location (Zv9):
Chromosome 10 (position 2944009)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2889646
GRCz11 10 2916817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGTTCTTTTGTTTCAGGCTTCCTACCGACGTCAGTTTGGTGGTCTA[C/A]ACTGAAGGGGCGCGAACAGACGACGGCTGGGACTTTTTGTTAGAGAAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alcohol dependence: Genome-wide association study of alcohol dependence. (View Study)
  • Ankylosing spondylitis: Genome-wide association study of ankylosing spondylitis identifies non-MHC susceptibility loci. (View Study)
  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Behcet's disease: Genome-wide association analysis identifies new susceptibility loci for Behçet's disease and epistasis between HLA-B*51 and ERAP1. (View Study)
  • Hodgkin's lymphoma: Genome-wide association study of classical Hodgkin lymphoma and Epstein-Barr virus status-defined subgroups. (View Study)
  • Psoriasis: A genome-wide association study identifies new psoriasis susceptibility loci and an interaction between HLA-C and ERAP1. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link