zgc:109983

Ensembl ID:
ENSDARG00000013023
ZFIN ID:
ZDB-GENE-050706-95
Description:
Putative methyltransferase NSUN3 [Source:UniProtKB/Swiss-Prot;Acc:Q4KMK0]
Human Orthologue:
NSUN3
Human Description:
NOP2/Sun domain family, member 3 [Source:HGNC Symbol;Acc:26208]
Mouse Orthologue:
Nsun3
Mouse Description:
NOL1/NOP2/Sun domain family member 3 Gene [Source:MGI Symbol;Acc:MGI:2146565]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa610 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023768 Nonsense 14 367 1 6
ENSDART00000131664 Nonsense 22 246 1 4

The following transcripts of ENSDARG00000013023 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 33329977)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32964728
GRCz11 1 33697296
KASP Assay ID:
554-0520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTCTGCATGTCAGGCAGTTCATTTCTCTTTCTGAAGTCTATTAAGTG[T/A]ATTCTGTCCTCTTCATGTCATGGCCAAAACACAATCTCTAATACAGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link