zgc:92901

Ensembl ID:
ENSDARG00000013005
ZFIN ID:
ZDB-GENE-040927-3
Description:
opioid-binding protein/cell adhesion molecule [Source:RefSeq peptide;Acc:NP_001005580]
Human Orthologues:
NTM, OPCML
Human Descriptions:
neurotrimin [Source:HGNC Symbol;Acc:17941]
opioid binding protein/cell adhesion molecule-like [Source:HGNC Symbol;Acc:8143]
Mouse Orthologues:
Ntm, Opcml
Mouse Descriptions:
neurotrimin Gene [Source:MGI Symbol;Acc:MGI:2446259]
opioid binding protein/cell adhesion molecule-like Gene [Source:MGI Symbol;Acc:MGI:97397]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12921 Nonsense Available for shipment Available now
sa34933 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020054 Nonsense 65 342 2 7
Genomic Location (Zv9):
Chromosome 10 (position 31737546)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 30838895
GRCz11 10 30725235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTGTTCAACAGGTGCAGTGTGGACAACAAAGTATCACGGGTGGCATG[G/A]CTCAACCGGACCACCATCCTCTTCACGGGCAATGAGAAATGGTCATTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020054 Nonsense 182 342 4 7
Genomic Location (Zv9):
Chromosome 10 (position 31639457)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 30740806
GRCz11 10 30627146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTATGTGTGTGTCGCCACAGGGAACCGTATCGTGACGGAGGGCGAATA[T/G]GTGGAAATGACAGGAATCACTAAAGACATGTCAGGCTCATATGACTGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link