zgc:110308

Ensembl ID:
ENSDARG00000012932
ZFIN ID:
ZDB-GENE-050320-38
Description:
Methionine adenosyltransferase 2 subunit beta [Source:UniProtKB/Swiss-Prot;Acc:Q5BJJ6]
Human Orthologue:
MAT2B
Human Description:
methionine adenosyltransferase II, beta [Source:HGNC Symbol;Acc:6905]
Mouse Orthologue:
Mat2b
Mouse Description:
methionine adenosyltransferase II, beta Gene [Source:MGI Symbol;Acc:MGI:1913667]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43679 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003978 Essential Splice Site 227 323 5 7
ENSDART00000135659 Essential Splice Site 238 334 5 7

The following transcripts of ENSDARG00000012932 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 30840779)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32040249
GRCz11 21 32073507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGATGTGGCTCGTGTCTGTCGGAACATGGCTGAGAGAGCCCTTCAGG[T/C]GAGTGCCTTATAGAGTGAATATTCTATAGCAAACACTGGTGTCGTGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging: Linkage and association of successful aging to the 6q25 region in large Amish kindreds. (View Study)
  • Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link