zgc:101710

Ensembl ID:
ENSDARG00000012915
ZFIN ID:
ZDB-GENE-041010-170
Description:
delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial [Source:RefSeq peptide;Acc:NP_001006068]
Human Orthologue:
ECH1
Human Description:
enoyl CoA hydratase 1, peroxisomal [Source:HGNC Symbol;Acc:3149]
Mouse Orthologue:
Ech1
Mouse Description:
enoyl coenzyme A hydratase 1, peroxisomal Gene [Source:MGI Symbol;Acc:MGI:1858208]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44817 Nonsense Mutation detected in F1 DNA During 2018
sa22588 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019330 Nonsense 199 308 7 10
ENSDART00000138546   None 122 None 4
Genomic Location (Zv9):
Chromosome 15 (position 6865923)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6941492
GRCz11 15 6938289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGCTGATGTTGGGACTTTGCAACGCCTTCCCAGAGTTATTGGAAGT[C/T]GAAGGTATTTACTTAATATTAAAGTTTGTTAAAAATTCAGCAGCAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019330 Nonsense 285 308 10 10
ENSDART00000138546   None 122 None 4
Genomic Location (Zv9):
Chromosome 15 (position 6855120)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 6930689
GRCz11 15 6927486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTGTTTGTTTCTGCAGAACACTTGGAATATGAGCATGCTTCAAACC[C/T]AAGATTTAATGAAATCAGCTCAGGCAGCGATGGAGAAGAAGAACCTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link