slc34a2a

Ensembl ID:
ENSDARG00000012903
ZFIN ID:
ZDB-GENE-000524-1
Description:
solute carrier family 34 (sodium phosphate), member 2a [Source:RefSeq peptide;Acc:NP_571699]
Human Orthologue:
SLC34A2
Human Description:
solute carrier family 34 (sodium phosphate), member 2 [Source:HGNC Symbol;Acc:11020]
Mouse Orthologue:
Slc34a2
Mouse Description:
solute carrier family 34 (sodium phosphate), member 2 Gene [Source:MGI Symbol;Acc:MGI:1342284]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32626 Nonsense Mutation detected in F1 DNA During 2018
sa12038 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024328 Nonsense 100 631 4 13
Genomic Location (Zv9):
Chromosome 1 (position 13320240)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13748982
GRCz11 1 14435495
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGTTTGTTTGCTCTCTGGACGTCCTAAGCTCAGCTTTCCAGCTTGTT[G/T]GAGGTATACATTAAAATTACAAATACACAAGAATATAGTTACCAAGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024328 Nonsense 266 631 8 13
Genomic Location (Zv9):
Chromosome 1 (position 13323386)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13752128
GRCz11 1 14438641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCAGCTGGACGAGWCTGTGATAAGCGGCATTGCGGTTGGCGATCCC[G/T]AAGCCAGAAATAAATCTCTTATCAAGGTCTGGTGCCACACAGCCTCRAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link