zgc:66100

Ensembl ID:
ENSDARG00000012892
ZFIN IDs:
ZDB-GENE-040426-1533, ZDB-GENE-040426-1533
Description:
AMMECR1 protein [Source:RefSeq peptide;Acc:NP_956875]
Human Orthologue:
AMMECR1
Human Description:
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1
Mouse Orthologue:
Ammecr1
Mouse Description:
Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24038 Nonsense Available for shipment Available now
sa24037 Essential Splice Site Available for shipment Available now
sa39351 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013814 Nonsense 11 322 1 6
ENSDART00000128776 Nonsense 60 371 2 7
Genomic Location (Zv9):
Chromosome 21 (position 43267920)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44707578
GRCz11 21 44731824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCCGCGCTGACGGTGATGGGTCGGAAGCGGTGTGTTGGTGCAGATTG[T/A]TCGAAGATGGCGGCCGGGTGCTGCGGGGTGAAGAAGCAAAAGTTGTCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013814 Essential Splice Site 147 322 1 6
ENSDART00000128776 Essential Splice Site 196 371 2 7
Genomic Location (Zv9):
Chromosome 21 (position 43267512)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44707170
GRCz11 21 44731416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATACGGATACCAGCCTCCTCGAACACCCAGGTTTACAAACGACCCCTA[G/A]TAAGTAGTAGCAAGATGGCTATGTTGACCTGGTTTACCTCAACAACAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013814 Essential Splice Site 252 322 4 6
ENSDART00000128776 Essential Splice Site 301 371 5 7
Genomic Location (Zv9):
Chromosome 21 (position 43248651)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44688309
GRCz11 21 44712555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATCAAAGCGCACCGCCACCTACCTGCCAGAGGTTGCGAAGGAGCAAG[G/T]TGAGCATTTCTGAGATCTTGAGGTTTATACTGCGCTCAACATTTGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link