Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mettl3
- Ensembl ID:
- ENSDARG00000012827
- ZFIN ID:
- ZDB-GENE-030131-9498
- Description:
- N6-adenosine-methyltransferase 70 kDa subunit [Source:RefSeq peptide;Acc:NP_997945]
- Human Orthologue:
- METTL3
- Human Description:
- methyltransferase like 3 [Source:HGNC Symbol;Acc:17563]
- Mouse Orthologue:
- Mettl3
- Mouse Description:
- methyltransferase like 3 Gene [Source:MGI Symbol;Acc:MGI:1927165]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa20914 | Essential Splice Site | Available for shipment | Available now |
| sa1579 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20914
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000019699 | Essential Splice Site | 246 | 584 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 23052833)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 21618018 GRCz11 7 21884356 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAAGTCTACTGAGCCAGCAATCCACTAAGGAACAGCAAAGCAAAAAGG[T/C]ATAATAATGAAGCAAAACAGCATGCTAAAGCCACTGTGATTTAAATGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1579
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000019699 | Nonsense | 533 | 584 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 23045365)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 21610550 GRCz11 7 21876888 - KASP Assay ID:
- 554-1522.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATAAACCAGATGAGATCTATGGAATGATTGAGCGCCTGTCTCCAGGCACA[C/T]GAAAGATTGAATTGTTTGGCAGGCCACACAATGTACAACCTAACTGGTGA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
