zgc:110682

Ensembl ID:
ENSDARG00000012723
ZFIN ID:
ZDB-GENE-050522-496
Description:
RNA binding motif protein 14 [Source:RefSeq peptide;Acc:NP_001108616]
Human Orthologue:
RBM14
Human Description:
RNA binding motif protein 14 [Source:HGNC Symbol;Acc:14219]
Mouse Orthologue:
Rbm14
Mouse Description:
RNA binding motif protein 14 Gene [Source:MGI Symbol;Acc:MGI:1929092]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13396 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009234 Nonsense 252 471 3 4
ENSDART00000122073 Nonsense 252 471 2 3
ENSDART00000142071 Nonsense 123 174 3 3
Genomic Location (Zv9):
Chromosome 21 (position 26769314)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27338225
GRCz11 21 27374920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTGACCACTTCCAGGGTTGATGGCAAAYCTGTGAGCTCCATGGTGTA[T/A]GGTGCGCTGGMGAGTCAAGTCTATAGTTCTGTCGCAGACCAGGTGATTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link