
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nkx1.2lb
- Ensembl ID:
- ENSDARG00000012697
- ZFIN ID:
- ZDB-GENE-040615-2
- Description:
- NK1 transcription factor related 2-like,b [Source:RefSeq peptide;Acc:NP_998713]
- Human Orthologue:
- NKX1-1
- Human Description:
- NK1 homeobox 1 [Source:HGNC Symbol;Acc:24975]
- Mouse Orthologues:
- Nkx1-1, Nkx1-2
- Mouse Descriptions:
- NK1 transcription factor related, locus 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109346]
- NK1 transcription factor related, locus 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104806]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2737 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2737
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000002085 | Nonsense | 212 | 373 | 2 | 2 |
ENSDART00000137414 | Nonsense | 185 | 346 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 14 (position 18967545)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 14761998 GRCz11 14 15067561 - KASP Assay ID:
- 554-2445.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGGACAGCAGACACAGCAGTCCTCGTCAAACGGACAGAATCACCAGGTG[A/T]AACCCAAACGGAAGCGCTCCGGGTCAGACTCAAAGTCTGGCAAACCCAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: