si:dkey-76b14.4

Ensembl ID:
ENSDARG00000012694
ZFIN IDs:
ZDB-GENE-030131-9749, ZDB-GENE-990415-35, ZDB-GENE-990415-35
Description:
Novel protein (Sb:cb26) [Source:UniProtKB/TrEMBL;Acc:B8JKW4]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32790 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10419 Essential Splice Site Available for shipment Available now
sa18656 Nonsense Available for shipment Available now
sa19621 Nonsense Available for shipment Available now
sa31242 Essential Splice Site Available for shipment Available now
sa8557 Nonsense Mutation detected in F1 DNA During 2018
sa39715 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31241 Nonsense Available for shipment Available now
sa1745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Essential Splice Site 24 1635 2 42
ENSDART00000052688 Essential Splice Site 23 1643 2 41
Genomic Location (Zv9):
Chromosome 1 (position 56720563)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55504496
GRCz11 1 56173792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTATTATTAAATACGCAAGTTTTCAAGCGCTCTGATTTGATCTCCTC[A/T]GATATGTGCTGTCGGCTCCTAATCTGCTGAGAGTGGGTTCATCAGAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Essential Splice Site 89 1635 2 42
ENSDART00000052688 Essential Splice Site 88 1643 2 41
Genomic Location (Zv9):
Chromosome 1 (position 56720365)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55504298
GRCz11 1 56173594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGAAWCTGAATGCACAAAACAATTTCCAGATCCTCACAGATATAAAG[G/A]TGAGCKCTCCTAAATCACAATGCASTGATGCCRTCTTTGCATTTCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Nonsense 241 1635 7 42
ENSDART00000052688 Nonsense 240 1643 7 41
Genomic Location (Zv9):
Chromosome 1 (position 56716807)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55500740
GRCz11 1 56170036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGTTTCAGTGCTTCCAACATTTGAGGTGAAATTACAACCCAGTAAAT[T/A]ATTCTACTATGTGGGCGAYGAAAGTCTGACAGTCGACATCGAAGCCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19621
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Nonsense 361 1635 10 42
ENSDART00000052688 Nonsense 360 1643 10 41
Genomic Location (Zv9):
Chromosome 1 (position 56713979)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55497912
GRCz11 1 56167208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGACGTCTCCATACACTATCAACTTCAAGAAAACAGCTCAATTCTTC[A/T]AACCTGGAATGCCCTTCGATGTCTCGGTATGAATTTGTTCACTATAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Essential Splice Site 369 1635 10 42
ENSDART00000052688 Essential Splice Site 368 1643 10 41
Genomic Location (Zv9):
Chromosome 1 (position 56713951)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55497884
GRCz11 1 56167180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAAAACAGCTCAATTCTTCAAACCTGGAATGCCCTTCGATGTCTCGG[T/A]ATGAATTTGTTCACTATAAAGTTACAAACATAAGCTGAAGAACACGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Nonsense 465 1635 12 42
ENSDART00000052688 Nonsense 464 1643 12 41
Genomic Location (Zv9):
Chromosome 1 (position 56713473)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55497406
GRCz11 1 56166702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACTACCTGCACATCGGCATTGATGYTGCGGAGCTTGAGATCGGTGAT[C/T]AAATGAAAGTCAATCTGAACACTGGGCAAAGTCCAGGAGTCAAAGATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Essential Splice Site 486 1635 12 42
ENSDART00000052688 Essential Splice Site 485 1643 12 41
Genomic Location (Zv9):
Chromosome 1 (position 56713406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55497339
GRCz11 1 56166635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACACTGGGCAAAGTCCAGGAGTCAAAGATCAAGATTACACATTTATGG[T/C]AATGATCGTTTGATATTCAGCTACACCACCAATGTACCATTTACACCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Nonsense 929 1635 23 42
ENSDART00000052688 Nonsense 937 1643 22 41
Genomic Location (Zv9):
Chromosome 1 (position 56701458)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55485391
GRCz11 1 56154687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTGTGCTGTTTCCACTGCAGAGGCCAAATGTAGAGCTCAATCCTGTT[A/T]AAAACGGTGAGATTTAATGTCAACCATGGAAACGAAGATGGATTATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024624 Nonsense 1287 1635 31 42
ENSDART00000052688 Nonsense 1295 1643 30 41
Genomic Location (Zv9):
Chromosome 1 (position 56692179)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55476112
GRCz11 1 56145408
KASP Assay ID:
554-1738.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGCTGGCTGTAGAAGGAAGAAGCAAACCTAGCAGATATACTATCAAA[A/T]GAGATAATCGGCATGTTTCACGATCAGACAAGGTGAGGAGGGGCTCTGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link