zgc:92006

Ensembl ID:
ENSDARG00000012674
ZFIN ID:
ZDB-GENE-040801-238
Description:
RNA pseudouridylate synthase domain-containing protein 4 [Source:UniProtKB/Swiss-Prot;Acc:Q6DBR0]
Human Orthologue:
RPUSD4
Human Description:
RNA pseudouridylate synthase domain containing 4 [Source:HGNC Symbol;Acc:25898]
Mouse Orthologue:
Rpusd4
Mouse Description:
RNA pseudouridylate synthase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1919239]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27755 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020283 Nonsense 272 358 6 7
Genomic Location (Zv9):
Chromosome 11 (position 18491504)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17857340
GRCz11 11 17991975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATGTGTGTTTTAGGTGTGAAAAACCAACTTCGAGTGCACATGGCTT[T/A]AGCGTTGACCTGCCCCATTCTTGGTGACCATAAATATTCCCACTGGAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link