zgc:92749

Ensembl ID:
ENSDARG00000012632
ZFIN ID:
ZDB-GENE-040718-309
Description:
hypothetical protein LOC436843 [Source:RefSeq peptide;Acc:NP_001002570]
Human Orthologue:
ELOVL6
Human Description:
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) [Sour
Mouse Orthologue:
Elovl6
Mouse Description:
ELOVL family member 6, elongation of long chain fatty acids (yeast) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22182 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007202 Nonsense 81 123 3 3
Genomic Location (Zv9):
Chromosome 12 (position 50205089)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48767785
GRCz11 12 48665713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGATTGTGTGTGTTTCAGTATTGTGGGCACGCTGCGGACCGGCTGGTA[C/A]ATGTTCAATGTGGTGTGTTCAGAGGGGTTCCGGCAGTCGGTGTGTGATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link