si:dkey-97a13.6

Ensembl ID:
ENSDARG00000012600
ZFIN ID:
ZDB-GENE-070912-617
Human Orthologue:
RP4-697K14.7
Human Description:
Peroxisomal proliferator-activated receptor A-interacting complex 285 kDa protein [Source:UniProtKB/
Mouse Orthologue:
BC006779
Mouse Description:
cDNA sequence BC006779 Gene [Source:MGI Symbol;Acc:MGI:2385169]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32992 Nonsense Available for shipment Available now
sa16820 Nonsense Available for shipment Available now
sa32991 Nonsense Available for shipment Available now
sa14969 Nonsense Available for shipment Available now
sa32990 Nonsense Available for shipment Available now
sa7515 Missense Mutation detected in F1 DNA During 2018
sa1075 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa32992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017829 Nonsense 184 2781 2 18
ENSDART00000131278   None 2190 None 14
Genomic Location (Zv9):
Chromosome 2 (position 42074658)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42124122
GRCz11 2 41973540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTAGATGATGTGCGTGTTACACACGATGAGAATCTCAGTATGGACTG[T/A]TTACAAGAGGACAATGAAATCAGATGGAAATTCACAATCACCACTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16820
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017829 Nonsense 365 2781 3 18
ENSDART00000131278   None 2190 None 14
Genomic Location (Zv9):
Chromosome 2 (position 42073997)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42123461
GRCz11 2 41972879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTCATCGGGAAAACTACAGAGAGAGGGCTCACCACTTCCTGTTCAGG[G/T]AGGAAATTGCAGAGGAGGAGCTCATTAGCAGGTATAGACAGCTTGTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017829 Nonsense 635 2781 5 18
ENSDART00000131278 Nonsense 44 2190 1 14
Genomic Location (Zv9):
Chromosome 2 (position 42065393)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42114857
GRCz11 2 41964275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGGCAAACAAGGGAGGGTCCGCTATCATAGCAACTGATGACATCACT[C/T]GAAAATACTGTCTCTGCTCTCGAGATGGACAGTCGTTCATCCTCCCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14969
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017829 Nonsense 718 2781 5 18
ENSDART00000131278 Nonsense 127 2190 1 14
Genomic Location (Zv9):
Chromosome 2 (position 42065144)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42114608
GRCz11 2 41964026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCTTAGCAGACAARCACACTYGAGTGGTTTTAGCAGGAGACCACATG[C/T]MGATGGCTCCAAAACTTTTCTCTGTAACCGATGACAAGAGATCAGAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017829 Nonsense 1188 2781 7 18
ENSDART00000131278 Nonsense 597 2190 3 14
Genomic Location (Zv9):
Chromosome 2 (position 42061917)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42111381
GRCz11 2 41960799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGGCAATTGGACAATAACAGGAAGAGTTCCTATTAATGAACAAACA[A/T]AACAGAACTATGTTTTTGTCGTGCAGATATTGGGCTGGAAAGAACACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017829 Missense 1438 2781 7 18
ENSDART00000131278 Missense 847 2190 3 14
Genomic Location (Zv9):
Chromosome 2 (position 42061167)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42110631
GRCz11 2 41960049
KASP Assay ID:
554-4246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCTATGCCCAGCYTAATAAACACCAGAAGCCAGGGGAGAGAGAAGCA[C/T]ATCGAATGATTGAAGAGTTAAACATCATGTTTAACCATGAAGTGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1075
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017829 Nonsense 1872 2781 7 18
ENSDART00000131278 Nonsense 1281 2190 3 14
Genomic Location (Zv9):
Chromosome 2 (position 42059863)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42109327
GRCz11 2 41958745
KASP Assay ID:
554-0977.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTGCTGTGTGAAAAGTGTAAAAGAGGAGAAAAGAGGGCACAGGAGTA[T/A]GAGAGCAAAGTTGAGGCACTTCAAATAGCAGTCAATCTACAGAAACAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link