si:dkey-87m23.1

Ensembl ID:
ENSDARG00000012593
ZFIN IDs:
ZDB-GENE-041105-6, ZDB-GENE-081104-44
Description:
Novel collagen protein [Source:UniProtKB/TrEMBL;Acc:B8JL13]
Human Orthologue:
COL5A1
Human Description:
collagen, type V, alpha 1 [Source:HGNC Symbol;Acc:2209]
Mouse Orthologue:
Col5a1
Mouse Description:
collagen, type V, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88457]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37227 Nonsense Mutation detected in F1 DNA During 2018
sa37228 Nonsense Mutation detected in F1 DNA During 2018
sa4934 Essential Splice Site F2 line generated During 2018
sa23852 Essential Splice Site Available for shipment Available now
sa5957 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43580 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45726 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027425 Nonsense 248 2024 5 65
ENSDART00000139598   None 126 None 2
Genomic Location (Zv9):
Chromosome 21 (position 6566655)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6687747
GRCz11 21 6609998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGTATTATTTGTTTGTCTTCAGAACCCAGAGGAGGATAACTATTATTA[T/G]GAATATCCCTACTATGAGGACATGGACTCAGACAAGACTGAAGAAACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027425 Nonsense 494 2024 7 65
ENSDART00000139598   None 126 None 2
Genomic Location (Zv9):
Chromosome 21 (position 6570498)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6691590
GRCz11 21 6613841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGTTATGATGATGCCCAGTATGGCGAGAGTTATGATCTGTCCTACGGC[G/T]AGGGATACGGAGAAGGATACGGAGAAGGAGATTATACTGTAGGAGGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4934
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027425 Essential Splice Site 661 2024 9 65
ENSDART00000139598   None 126 None 2
Genomic Location (Zv9):
Chromosome 21 (position 6581864)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6702956
GRCz11 21 6625207
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAGGGAATGCTGGTGGAAGGTCCGTCCGGTCCTGAGGGTCCAACGG[T/C]GAGTCAGCTTGTGCTTTTGTGTTTCTCCACACACACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027425 Essential Splice Site 793 2024 15 65
ENSDART00000139598   None 126 None 2
Genomic Location (Zv9):
Chromosome 21 (position 6595655)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6716747
GRCz11 21 6638998
KASP Assay ID:
2261-5206.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGTGGTCCAATGGGATCTGCAGGCCCTACCGGAAAGCCTGGTAGAAGG[G/A]TAGGTTTGCATTTCGCTGAAATCCCCCAGGCTGGTGTGATTGTTATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027425 Essential Splice Site 881 2024 21 65
ENSDART00000139598   None 126 None 2
Genomic Location (Zv9):
Chromosome 21 (position 6599416)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6720508
GRCz11 21 6642759
KASP Assay ID:
554-3852.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTTGCTGAATTAGTTTTTCTCAGTTTTGGTCTGGTTTTAATTGTTTT[A/C]GGGTGTGACTGGTATGGACGGACACCCAGGACCTAAAGGAAACATTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027425 Essential Splice Site 881 2024 21 65
ENSDART00000139598   None 126 None 2
Genomic Location (Zv9):
Chromosome 21 (position 6599417)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6720509
GRCz11 21 6642760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTGCTGAATTAGTTTTTCTCAGTTTTGGTCTGGTTTTAATTGTTTTA[G/T]GGTGTGACTGGTATGGACGGACACCCAGGACCTAAAGGAAACATTGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027425 Essential Splice Site 1132 2024 34 65
ENSDART00000139598   None 126 None 2
Genomic Location (Zv9):
Chromosome 21 (position 6617407)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 6738499
GRCz11 21 6660750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGCAACTCTGGAAGCGATGGCCCCCCAGGACCACCCGGTGAACGGG[T/C]ATGGTAGAAATAGTCATTGAACTAATCCAAAGAATTGATTATTCTATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link