
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
waca
- Ensembl ID:
- ENSDARG00000012577
- ZFIN ID:
- ZDB-GENE-030131-2624
- Description:
- WW domain-containing adapter protein with coiled-coil [Source:RefSeq peptide;Acc:NP_955954]
- Human Orthologue:
- WAC
- Human Description:
- WW domain containing adaptor with coiled-coil [Source:HGNC Symbol;Acc:17327]
- Mouse Orthologue:
- Wac
- Mouse Description:
- WW domain containing adaptor with coiled-coil Gene [Source:MGI Symbol;Acc:MGI:2387357]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18510 | Essential Splice Site | Available for shipment | Available now |
sa17676 | Essential Splice Site | Available for shipment | Available now |
sa35296 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18510
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078896 | Essential Splice Site | 118 | 558 | 4 | 13 |
- Genomic Location (Zv9):
- Chromosome 12 (position 24802124)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 23258464 GRCz11 12 23379683 - KASP Assay ID:
- 2260-5366.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTGCACAGCTCCAACTCCCATTCGAATCCCAACAAAWCATCAGACAYGG[T/G]AAGCACTACAGTCTCWGTCATCTNNNNNNNNNNNNACATGAAATGAGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17676
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078896 | Essential Splice Site | 493 | 558 | 11 | 13 |
- Genomic Location (Zv9):
- Chromosome 12 (position 24831680)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 23288020 GRCz11 12 23409239 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTCATCAAACATGTGCAGGGGTGGCCTGCCGAGCACGTGGAGAAGCAGG[T/C]AGAACCTCTTTTGTTTCTCACCAACTTTATAAAATTGCYTTTATTCAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35296
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000078896 | Nonsense | 495 | 558 | 12 | 13 |
- Genomic Location (Zv9):
- Chromosome 12 (position 24833657)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 23289997 GRCz11 12 23411216 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGATACATTTGTTGCATCTTAATTGCTTTGTCTCTTCCGTTCAGGCCT[C/A]GCGGTTACGTGAAGAGGCTCACACCATGGGCAGCATCTACATGTCAGAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: