waca

Ensembl ID:
ENSDARG00000012577
ZFIN ID:
ZDB-GENE-030131-2624
Description:
WW domain-containing adapter protein with coiled-coil [Source:RefSeq peptide;Acc:NP_955954]
Human Orthologue:
WAC
Human Description:
WW domain containing adaptor with coiled-coil [Source:HGNC Symbol;Acc:17327]
Mouse Orthologue:
Wac
Mouse Description:
WW domain containing adaptor with coiled-coil Gene [Source:MGI Symbol;Acc:MGI:2387357]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18510 Essential Splice Site Available for shipment Available now
sa17676 Essential Splice Site Available for shipment Available now
sa35296 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078896 Essential Splice Site 118 558 4 13
Genomic Location (Zv9):
Chromosome 12 (position 24802124)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23258464
GRCz11 12 23379683
KASP Assay ID:
2260-5366.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCACAGCTCCAACTCCCATTCGAATCCCAACAAAWCATCAGACAYGG[T/G]AAGCACTACAGTCTCWGTCATCTNNNNNNNNNNNNACATGAAATGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078896 Essential Splice Site 493 558 11 13
Genomic Location (Zv9):
Chromosome 12 (position 24831680)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23288020
GRCz11 12 23409239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCATCAAACATGTGCAGGGGTGGCCTGCCGAGCACGTGGAGAAGCAGG[T/C]AGAACCTCTTTTGTTTCTCACCAACTTTATAAAATTGCYTTTATTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078896 Nonsense 495 558 12 13
Genomic Location (Zv9):
Chromosome 12 (position 24833657)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23289997
GRCz11 12 23411216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGATACATTTGTTGCATCTTAATTGCTTTGTCTCTTCCGTTCAGGCCT[C/A]GCGGTTACGTGAAGAGGCTCACACCATGGGCAGCATCTACATGTCAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link