zgc:92440

Ensembl ID:
ENSDARG00000012539
ZFIN ID:
ZDB-GENE-040718-423
Description:
deoxyribonuclease-1 [Source:RefSeq peptide;Acc:NP_001002674]
Human Orthologues:
DNASE1, DNASE1L2
Human Descriptions:
deoxyribonuclease I [Source:HGNC Symbol;Acc:2956]
deoxyribonuclease I-like 2 [Source:HGNC Symbol;Acc:2958]
Mouse Orthologues:
Dnase1, Dnase1l2
Mouse Descriptions:
deoxyribonuclease 1-like 2 Gene [Source:MGI Symbol;Acc:MGI:1913955]
deoxyribonuclease I Gene [Source:MGI Symbol;Acc:MGI:103157]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40076 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019098 Nonsense 157 278 6 9
Genomic Location (Zv9):
Chromosome 3 (position 27932363)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27650402
GRCz11 3 27781244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTCTAGCTGTCCGAGACTTTGCTCTCGTTCCTCAACACACATCCCCA[G/T]AAGTGGCTGTGCAGGAAATCGATGCTCTGCATGATGTCGTCTTGGACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link