u2af2a

Ensembl ID:
ENSDARG00000012505
ZFIN ID:
ZDB-GENE-050706-131
Description:
U2 small nuclear RNA auxiliary factor 2a [Source:RefSeq peptide;Acc:NP_001025127]
Human Orthologue:
U2AF2
Human Description:
U2 small nuclear RNA auxiliary factor 2 [Source:HGNC Symbol;Acc:23156]
Mouse Orthologue:
U2af2
Mouse Description:
U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 Gene [Source:MGI Symbol;Acc:MGI:98886]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36062 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008535 Nonsense 10 465 1 11
ENSDART00000124875 Nonsense 10 470 1 11
Genomic Location (Zv9):
Chromosome 16 (position 14564355)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12922814
GRCz11 16 12812934
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCGTGTCGGAGCTGCTGGAAAATGTCAGACTTTGACGAGTTTGAGAGA[C/T]AGCTGACCGAAAACAAACAAGGTGAGATATTAAGGTATAAACTGGGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link