si:dkey-266j7.1

Ensembl ID:
ENSDARG00000012482
ZFIN ID:
ZDB-GENE-030131-8100
Description:
Novel protein similar to H.sapiens PCLO, piccolo (Presynaptic cytomatrix protein) (PCLO) [Source:Uni
Human Orthologue:
BSN
Human Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Mouse Orthologue:
Bsn
Mouse Description:
bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]

Alleles

There are 16 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18586 Essential Splice Site Available for shipment Available now
sa36579 Nonsense Mutation detected in F1 DNA During 2018
sa39190 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45631 Nonsense Mutation detected in F1 DNA During 2018
sa11698 Essential Splice Site Available for shipment Available now
sa43053 Nonsense Mutation detected in F1 DNA During 2018
sa9177 Nonsense Mutation detected in F1 DNA During 2018
sa15776 Nonsense Available for shipment Available now
sa10741 Nonsense Available for shipment Available now
sa43054 Nonsense Mutation detected in F1 DNA During 2018
sa1035 Nonsense F2 line generated During 2018
sa5793 Nonsense F2 line generated During 2018
sa1178 Nonsense Confirmed mutation in F2 line During 2018
sa11836 Nonsense Available for shipment Available now
sa13696 Nonsense Available for shipment Available now
sa23238 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Essential Splice Site 213 4478 4 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9087038)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9664014
GRCz11 18 9633204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTTAGAAGCTGAATTGAATAAAGAGCCACCAAAAAGCTGCCCCTTAT[G/A]TAAAGAGAYCCTCAAGAAAAYCCCACAAAACTATARCTCTTGCACTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 926 4478 16 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9096683)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9673659
GRCz11 18 9642849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTAAGTCCAAACTTGATGAGAATCCAACTGCAGCTCCCACTGAAAAG[A/T]AGGCTGGACCTGCTCAGGAAATAAAGAAAGACATTTCAGTTCAAAAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Essential Splice Site 956 4478 18 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9101885)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9678861
GRCz11 18 9648051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTTTGCAATAAAAAGGAGTGATTTTTGTTTGTTAGAATCATGTTTAG[G/A]TGAACTGTGACATTAGAGCGATGATTTAAAATGCATGGTCAATGCATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 982 4478 21 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9121530)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9698506
GRCz11 18 9667696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATACAGATAGATACCAGTCTTACAGAAATTTCTAAAGTAGATACCT[T/A]GAAAGCAGATACTAAAGAGCAACAAAGAAAGGACATCTTACCAGTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Essential Splice Site 1831 4478 24 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9124532)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9701509
GRCz11 18 9670699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTAGAGATGTTCAGCCACCAGCCAGTGTTTCAATTCAAATTCCCATTC[A/G]GAGACTAGTGGAAACCAGATCAGATATTGCACCAYCAKTACWTCAAGCCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 2094 4478 27 55
ENSDART00000136955 Nonsense 11 1644 1 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9126565)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9703542
GRCz11 18 9672732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTGACACCTTGCCTAAGCTTGTAACCCAAGTTGTCACGACTGAAGTG[C/T]AAAGAACAACAACTGTGTCAGTTGTCCAGGAGAGGATTCCTGTAGACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 2178 4478 27 55
ENSDART00000136955 Nonsense 95 1644 1 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9126817)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9703794
GRCz11 18 9672984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCCCAGACTCAAGTAGGTCTTTTCTGTCAAGTGAATCAAGTGGCCGA[C/T]AGGCTACTGCTGTACAGCCGGAAATTGTGAAWCTTAGTGCTGAAATAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 2352 4478 27 55
ENSDART00000136955 Nonsense 269 1644 1 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9127339)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9704316
GRCz11 18 9673506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGTTGTGGAAGATGACGGTACACCAGTTGATCTKACATCTGGTAGA[C/T]RAACAGTTTGCTGYGATGTTATTTACWGRCTTCCGTTCACAGGGAGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 2754 4478 28 55
ENSDART00000136955 Nonsense 671 1644 2 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9128886)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9705863
GRCz11 18 9675053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACAATTCAATGTCWYCTGCGGTTTCCACCCATGACTCCACATTAGTT[C/T]AAAACTGGCAATCAACAACAGYACAGCACAGTTCAAACWTTCCTGWAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 2977 4478 28 55
ENSDART00000136955 Nonsense 894 1644 2 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9129556)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9706533
GRCz11 18 9675723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAATGTCCCCTGGGAAAAGTTCACAAAAGATGCTTACAGCTGATTCAT[C/A]AAGGCATCTCAGTAGTCCAAGATCACTACGGGCTTCACAACGATCTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1035
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 3108 4478 29 55
ENSDART00000136955 Nonsense 1025 1644 3 3
ENSDART00000142816   None 231 None 2
ENSDART00000048657 Nonsense 3108 4478 29 55
ENSDART00000136955 Nonsense 1025 1644 3 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9130116)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9707093
GRCz11 18 9676283
KASP Assay ID:
554-0938.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGATACAGGCAGAACTTGATGMGGAGGAGAAAGAGATAGATGCTAAAT[T/A]GAGATATCTGGAGATGGGTATAAATCGAAGAAAAGAGGCTTTATTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5793
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 3108 4478 29 55
ENSDART00000136955 Nonsense 1025 1644 3 3
ENSDART00000142816   None 231 None 2
ENSDART00000048657 Nonsense 3108 4478 29 55
ENSDART00000136955 Nonsense 1025 1644 3 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9130116)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9707093
GRCz11 18 9676283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGATACAGGCAGAACTTGATGMGGAGGAGAAAGAGATAGATGCTAAAT[T/A]GAGATATCTGGAGATGGGTATAAATCGAAGAAAAGAGGCTTTATTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1178
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 3642 4478 30 55
ENSDART00000136955 Nonsense 1567 1644 3 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9131741)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9708718
GRCz11 18 9677908
KASP Assay ID:
554-1088.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAAGTCTGCCAATCAGTCAGAGCAGAGGTCGAATCCCCATTGTTGCA[C/T]AAAACTCTGAGGAAGAGAGTCCATTGAGCCCTGTGGGTCAGCCCATGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 4027 4478 40 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9147477)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9724454
GRCz11 18 9693644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCTCCGAGAGAAAACAAYGGATACACAGACCCTTTCGTCAAAGTCTA[T/A]CTCTTACCAGGCAGAGGGTGAGTATCTGTARGTGTGTGTGTGTRTNNGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 4027 4478 40 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9147477)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9724454
GRCz11 18 9693644
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCTCCGAGAGAAAACAAYGGATACACAGACCCTTTCGTCAAAGTCTA[T/A]CTCTTACCAGGCAGAGGGTGAGTATCTGTARGTGTGTGTGTGTRTNNGTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23238
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048657 Nonsense 4219 4478 47 55
ENSDART00000136955   None 1644 None 3
ENSDART00000142816   None 231 None 2
Genomic Location (Zv9):
Chromosome 18 (position 9158768)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9735745
GRCz11 18 9704935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGCCGGAAACGCCATCGCTGCAGCGGAAGCTGCCGTCCATCAATCC[C/T]GACTCCAGCCAAGTAACCCTTACTACTTCACATGAGCTCACAGCCTCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link