zgc:92261

Ensembl ID:
ENSDARG00000012460
ZFIN ID:
ZDB-GENE-050102-3
Description:
hypothetical protein LOC494494 [Source:RefSeq peptide;Acc:NP_001009985]
Human Orthologue:
RASSF4
Human Description:
Ras association (RalGDS/AF-6) domain family member 4 [Source:HGNC Symbol;Acc:20793]
Mouse Orthologue:
Rassf4
Mouse Description:
Ras association (RalGDS/AF-6) domain family member 4 Gene [Source:MGI Symbol;Acc:MGI:2386853]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45490 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100803   None 324 None 11
ENSDART00000126835   None 211 11 11
ENSDART00000139073 Nonsense 316 317 12 12

The following transcripts of ENSDARG00000012460 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30889744)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30535692
GRCz11 12 1349301
GRCz11 13 30666142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAGTGATATTGCAGAAATTGGATGGCATCTCTGAGAATGCAAGTTA[T/A]GTGTGAGGAAAATGTGCTGAGATTAGAGGCTTTTTCTCTGTGTTTGAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link