
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tmem49
- Ensembl ID:
- ENSDARG00000012450
- ZFIN ID:
- ZDB-GENE-030131-8733
- Description:
- Transmembrane protein 49 [Source:UniProtKB/Swiss-Prot;Acc:Q6NYY9]
- Human Orthologue:
- TMEM49
- Human Description:
- transmembrane protein 49 [Source:HGNC Symbol;Acc:29559]
- Mouse Orthologue:
- Tmem49
- Mouse Description:
- transmembrane protein 49 Gene [Source:MGI Symbol;Acc:MGI:1923159]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35848 | Splice Site, Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32025 | Essential Splice Site, Missense | Available for shipment | Available now |
sa10666 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa35848
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018461 | Splice Site, Nonsense | 102 | 406 | 5 | 12 |
ENSDART00000111753 | Splice Site, Nonsense | 102 | 149 | 5 | 7 |
The following transcripts of ENSDARG00000012450 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 16369331)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 17414294 GRCz11 15 17350316 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACTGCATCTTCTCTTTGTGATCTGGATGTGTTTGCTGTTGTTTGTAGTA[T/A]GTGCAGCACCTGGAGAAGAAGTTCCTGTGGTGTGCCTACTGGGTAGGCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32025
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018461 | Missense | 134 | 406 | 5 | 12 |
ENSDART00000111753 | Essential Splice Site | 133 | 149 | None | 7 |
The following transcripts of ENSDARG00000012450 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 16369425)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 17414388 GRCz11 15 17350410 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGGCCTGGGTATTTTGTCTTCGGTTGGTCTCGGCACTGGACTACATACG[T/A]TTCTCCTGTACCTGGTAAGAGTTCTTGGCTTAAATTTAGACTTTCTCTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10666
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000018461 | Nonsense | 319 | 406 | 10 | 12 |
ENSDART00000111753 | None | 149 | None | 7 |
The following transcripts of ENSDARG00000012450 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 16384268)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 17429231 GRCz11 15 17365253 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCTGCAGAAACTGTTTGTTATCATTACGTTCAGCAAGCACATAGTGGAG[C/T]AGATGGTGTCTCTGATCGGGTGAGTAACAATGGACAGACAGTGCTAAACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Lipoprotein-associated phospholipase A2 activity change in response to statin therapy: Genome-wide association study evaluating lipoprotein-associated phospholipase A2 mass and activity at baseline and after rosuvastatin therapy. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: