
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam76b
- Ensembl ID:
- ENSDARG00000012432
- ZFIN ID:
- ZDB-GENE-030131-6955
- Description:
- Protein FAM76B [Source:UniProtKB/Swiss-Prot;Acc:Q6PBM7]
- Human Orthologue:
- FAM76B
- Human Description:
- family with sequence similarity 76, member B [Source:HGNC Symbol;Acc:28492]
- Mouse Orthologue:
- Fam76b
- Mouse Description:
- family with sequence similarity 76, member B Gene [Source:MGI Symbol;Acc:MGI:1920076]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20397 | Nonsense | Available for shipment | Available now |
sa33586 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa20397
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024815 | Nonsense | 62 | 328 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25261288)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23088553 GRCz11 5 23592353 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATCTTTCCTTTCGTTCAGCAAAACCAACACTATCTGTAAGAAATGCGCA[C/T]AGAATGTCAAACAGTTTGGAACAGTAAGTTGACATCATGTTTAAAAAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33586
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000024815 | Nonsense | 244 | 328 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 5 (position 25258731)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 23085996 GRCz11 5 23589796 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGATTCTGGAGGCACGGATAACTTCATCTTGATTAGCCAGCTGAAAGAG[G/T]AAGTGATGTCACTGAAGCGCATGCTCCAGCAGAGAGACCAGACCATCCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: