zgc:66030

Ensembl ID:
ENSDARG00000012407
ZFIN ID:
ZDB-GENE-040426-1515
Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase [Source:RefSeq peptide;
Human Orthologue:
MGAT1
Human Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Mgat1
Mouse Description:
mannoside acetylglucosaminyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:96973]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9475 Nonsense Available for shipment Available now
sa19121 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123182 Nonsense 411 502 2 2
ENSDART00000123182 Nonsense 411 502 2 2
Genomic Location (Zv9):
Chromosome 15 (position 34164627)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35010403
GRCz11 15 34868372
KASP Assay ID:
2260-8814.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGCCTTTTAMAAAAATGGACCTGTCTTATTTAGAGAAGGAGAAATA[T/G]GATGAGAGCTTTGAGAAGGARGTTTACGCTGCTTCACTTGTCACATTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19121
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123182 Nonsense 411 502 2 2
ENSDART00000123182 Nonsense 411 502 2 2
Genomic Location (Zv9):
Chromosome 15 (position 34164627)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35010403
GRCz11 15 34868372
KASP Assay ID:
2260-8814.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGCCTTTTACAAAAATGGACCTGTCTTATTTAGAGAAGGAGAAATA[T/G]GATGAGAGCTTTGAGAAGGAGGTTTACGCTGCTTCACTTGTCACATTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link