
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
A2RUZ9_DANRE
- Ensembl ID:
- ENSDARG00000012403
- Description:
- LOC553504 protein [Source:UniProtKB/TrEMBL;Acc:A2RUZ9]
- Human Orthologue:
- C9orf102
- Human Description:
- chromosome 9 open reading frame 102 [Source:HGNC Symbol;Acc:26922]
- Mouse Orthologue:
- 0610007P08Rik
- Mouse Description:
- RIKEN cDNA 0610007P08 gene Gene [Source:MGI Symbol;Acc:MGI:1923501]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41233 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9243 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa25397 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41233
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061993 | Nonsense | 64 | 1105 | 4 | 20 |
ENSDART00000122774 | Nonsense | 66 | 1269 | 1 | 17 |
ENSDART00000125173 | Nonsense | 64 | 1100 | 3 | 19 |
- Genomic Location (Zv9):
- Chromosome 8 (position 30774771)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 29917497 GRCz11 8 29926729 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTAAAAGTTCCGTACACCATCAATCGGTATTTACGGGACTACCAGCGA[G/T]AAGGCATTAAATTCATCTATCAAAACTATGCCAAATCCAGAGGATGCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9243
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061993 | Essential Splice Site | 92 | 1105 | None | 20 |
ENSDART00000122774 | Essential Splice Site | 94 | 1269 | None | 17 |
ENSDART00000125173 | Essential Splice Site | 92 | 1100 | None | 19 |
- Genomic Location (Zv9):
- Chromosome 8 (position 30774683)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 29917409 GRCz11 8 29926641 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGAGGATGCATCTTGGGTGATGATATGGGGCTTGGAAAGACTGTTCAGG[T/G]WAAAGCACACACATTTTTSTAAAGAGTATACATAGTAAAGACTGCTTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25397
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000061993 | Nonsense | 121 | 1105 | 5 | 20 |
ENSDART00000122774 | Nonsense | 123 | 1269 | 2 | 17 |
ENSDART00000125173 | Nonsense | 121 | 1100 | 4 | 19 |
- Genomic Location (Zv9):
- Chromosome 8 (position 30774522)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 29917248 GRCz11 8 29926480 - KASP Assay ID:
- 554-7519.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGGTACATGGAAAGATGTTGAGAACAACAGGCCTCAGTTTTTGCTGTCA[C/T]AAAAACCATCAGAACGAGTTCAGAAGGTGACACATGCTTTTTAGTCAGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: