ttc21b

Ensembl ID:
ENSDARG00000012368
ZFIN ID:
ZDB-GENE-031010-34
Description:
tetratricopeptide repeat protein 21B [Source:RefSeq peptide;Acc:NP_001121730]
Human Orthologue:
TTC21B
Human Description:
tetratricopeptide repeat domain 21B [Source:HGNC Symbol;Acc:25660]
Mouse Orthologue:
Ttc21b
Mouse Description:
tetratricopeptide repeat domain 21B Gene [Source:MGI Symbol;Acc:MGI:1920918]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34770 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31749 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044270 Essential Splice Site 400 1321 10 29
ENSDART00000138937   None 189 None 5
Genomic Location (Zv9):
Chromosome 9 (position 51033132)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 50148093
GRCz11 9 49845484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACTGGAGTTTCTCACAGAGATCCAGCAGTCCATTGGCAAATCAGGGG[T/C]GAGAAAAAATTTATGTGCCCTACTATCTTCATTCATTCATGTTCTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31749
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044270 Essential Splice Site 1234 1321 27 29
ENSDART00000138937   None 189 None 5
Genomic Location (Zv9):
Chromosome 9 (position 51067481)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 50113744
GRCz11 9 49811135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCTTTTTGGTAACTGTGCTATGCTGATGTTTTAACATGTTCAACACT[A/C]GTCCTGCTGTAAGGCGTATGAGTACATGGGCTACATTATGGAGAAAGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link