galnt8a

Ensembl ID:
ENSDARG00000012355
ZFIN ID:
ZDB-GENE-091015-4
Human Orthologue:
GALNT8
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8) [Sour

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30227 Nonsense Mutation detected in F1 DNA During 2018
sa24636 Nonsense Available for shipment Available now
sa45848 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025186 Nonsense 352 556 7 11
Genomic Location (Zv9):
Chromosome 25 (position 17094819)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16641363
GRCz11 25 16737763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAAGAGCACATAAGCCTTATTCACCAGATCTCAGCAAACCCATGATC[C/T]GAAACGCATTGAGAGTGGCTGAAATCTGGATGGATGAATATAAATCCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025186 Nonsense 453 556 9 11
Genomic Location (Zv9):
Chromosome 25 (position 17094316)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16640860
GRCz11 25 16737260
KASP Assay ID:
2261-9523.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGACCTGTTCCTGGAAGTGTGCCTATTCTCTACGGATGTCATTACTA[T/G]GAGCCTCAGGTATACTGTATATGTATATTTTACTGTGTGTAAGGAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025186 Nonsense 460 556 10 11
Genomic Location (Zv9):
Chromosome 25 (position 17091522)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16638066
GRCz11 25 16734466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCTCAAAGCCTTATTTATGTCATCTTCTTTCACAGTATTGTTTTTA[C/A]AACCAAAATGGAGAAATCTACATTGGTGGCATTAAATCCCACACTTATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link