vipr2

Ensembl ID:
ENSDARG00000012353
ZFIN ID:
ZDB-GENE-010406-4
Description:
vasoactive intestinal peptide receptor 2 [Source:RefSeq peptide;Acc:NP_571854]
Human Orthologue:
VIPR2
Human Description:
vasoactive intestinal peptide receptor 2 [Source:HGNC Symbol;Acc:12695]
Mouse Orthologue:
Vipr2
Mouse Description:
vasoactive intestinal peptide receptor 2 Gene [Source:MGI Symbol;Acc:MGI:107166]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14660 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14660
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122639 Essential Splice Site 294 441 9 13
Genomic Location (Zv9):
Chromosome 24 (position 28207634)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27258221
GRCz11 24 27337380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCGATTCCCTGGCGCGTGATCAACTGGCCAATCATGGCATCTGTCATT[G/A]TGAGTAYAMCCTCAYACCCGTACTTCYAAACACRCAGACCAGCCTCATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link