ptpn11b

Ensembl ID:
ENSDARG00000012340
ZFIN ID:
ZDB-GENE-040426-1158
Description:
protein tyrosine phosphatase, non-receptor type 11, b [Source:RefSeq peptide;Acc:NP_956748]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11510 Nonsense Available for shipment Available now
sa11037 Essential Splice Site Available for shipment Available now
sa7505 Missense Mutation detected in F1 DNA During 2018
sa37695 Nonsense Mutation detected in F1 DNA During 2018
sa45799 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046951 Nonsense 84 592 3 16
Genomic Location (Zv9):
Chromosome 23 (position 24257882)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24044448
GRCz11 23 23970999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGGAGAAGTTCGCCACGCTGRCTGAGCTGGTCCAGTATTACACCGAG[C/T]AGCACGACCTCCTKAGGGAACGCAATGGAGATGTTATTGAGCTCAAAWAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046951 Essential Splice Site 111 592 3 16
Genomic Location (Zv9):
Chromosome 23 (position 24257966)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24044532
GRCz11 23 23971083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTGAGCTCAAAWACCCACTCAACTGCAAAGACCCCACATCTGAGAGG[T/C]ACAGTCTTTCCAAATCTCTACCTAGACTTAATATTGAGTGGACAGAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046951 Missense 304 592 8 16
Genomic Location (Zv9):
Chromosome 23 (position 24267930)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24054496
GRCz11 23 23981047
KASP Assay ID:
554-4142.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAYTCGAGTGCAGATCAAGGAAGMGGATCCTGATGTTCCCGGATCCGAT[T/C]ACATCAACGCTAACTATATCCGAGTAAGACCCCGCTTCGCTCGTAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046951 Nonsense 362 592 9 16
Genomic Location (Zv9):
Chromosome 23 (position 24268242)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24054808
GRCz11 23 23981359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGGAAAATACACATGTTATTGTCATGACAACCAAGGAGATGGAGAGA[G/T]GACGGGTAAGGTCCAGGATGAAAATATTGTACATTCATTCATTCATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046951 Nonsense 480 592 12 16
Genomic Location (Zv9):
Chromosome 23 (position 24274294)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24060860
GRCz11 23 23987411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAACAGGCACAATTATCGTGATTGACATTCTTATCGACATCATAAAT[A/T]GACAAGGTAAGCATTTCATACAGAATTATCCCAGTGGTGTCTTTTTTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link