zgc:158654

Ensembl ID:
ENSDARG00000012338
ZFIN ID:
ZDB-GENE-070209-232
Description:
hypothetical protein LOC100009639 [Source:RefSeq peptide;Acc:NP_001076477]
Human Orthologue:
C16orf45
Human Description:
chromosome 16 open reading frame 45 [Source:HGNC Symbol;Acc:19213]
Mouse Orthologue:
2900011O08Rik
Mouse Description:
RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40670 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40671 Nonsense Mutation detected in F1 DNA During 2018
sa33843 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054934 Essential Splice Site 26 192 1 6
Genomic Location (Zv9):
Chromosome 6 (position 19881302)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23652995
GRCz11 6 23752804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACGGATCCCTGGAATGCACGAAATGGAAAACAGATGTGGACCAAACAG[G/A]TATCCCTACACCTGGCTGTCATTGTAGCAAAACCTGTCAAAACGTATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054934 Nonsense 48 192 2 6
Genomic Location (Zv9):
Chromosome 6 (position 19896335)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23668028
GRCz11 6 23767837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATGGCGGACTCTACTATCACAGTTGGTGACATTGAGGGTGAACTCTG[T/A]AAGATTGAACGGATAAGAGACATTTTGATAAGGAGGGAATCTGAACTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054934 Nonsense 65 192 2 6
Genomic Location (Zv9):
Chromosome 6 (position 19896384)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23668077
GRCz11 6 23767886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGATTGAACGGATAAGAGACATTTTGATAAGGAGGGAATCTGAACTC[C/T]GATACATGTGAGTAAACTGTAAATAGTTGTATACTGTGCACTGTGAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link