zgc:110269

Ensembl ID:
ENSDARG00000012325
ZFIN ID:
ZDB-GENE-050417-81
Description:
flap structure-specific endonuclease 1-like [Source:RefSeq peptide;Acc:NP_001017611]
Human Orthologue:
GEN1
Human Description:
Gen homolog 1, endonuclease (Drosophila) [Source:HGNC Symbol;Acc:26881]
Mouse Orthologue:
Gen1
Mouse Description:
Gen homolog 1, endonuclease (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443149]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39801 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19712 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005381 Essential Splice Site 53 350 2 11
ENSDART00000100307   None 135 None 4
Genomic Location (Zv9):
Chromosome 2 (position 16271945)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16782772
GRCz11 2 16451362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGGTGAATCAGTTCCGTTCAGCTCTCCCTGGCCATCTGAAACTAAG[G/T]TCAGTTCAATTCATTTTTTGTATTGCCCTTCTAGGGCTGGGCGATTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005381 Splice Site, Nonsense 285 350 9 11
ENSDART00000100307 Splice Site, Nonsense 70 135 2 4
Genomic Location (Zv9):
Chromosome 2 (position 16278378)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16789205
GRCz11 2 16457795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTGATGAAGAAGGTCTGGTGCAGTTCCTGTGCAAGGAGAAACCTTTA[A/T]AGTATGCCTACATATTCTAGTATTATAGAGTGTTTGCCATTAATTGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link