
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110269
- Ensembl ID:
- ENSDARG00000012325
- ZFIN ID:
- ZDB-GENE-050417-81
- Description:
- flap structure-specific endonuclease 1-like [Source:RefSeq peptide;Acc:NP_001017611]
- Human Orthologue:
- GEN1
- Human Description:
- Gen homolog 1, endonuclease (Drosophila) [Source:HGNC Symbol;Acc:26881]
- Mouse Orthologue:
- Gen1
- Mouse Description:
- Gen homolog 1, endonuclease (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443149]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39801 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa19712 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39801
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005381 | Essential Splice Site | 53 | 350 | 2 | 11 |
ENSDART00000100307 | None | 135 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16271945)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16782772 GRCz11 2 16451362 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTGTGGTGAATCAGTTCCGTTCAGCTCTCCCTGGCCATCTGAAACTAAG[G/T]TCAGTTCAATTCATTTTTTGTATTGCCCTTCTAGGGCTGGGCGATTAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19712
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005381 | Splice Site, Nonsense | 285 | 350 | 9 | 11 |
ENSDART00000100307 | Splice Site, Nonsense | 70 | 135 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16278378)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 16789205 GRCz11 2 16457795 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCCTGATGAAGAAGGTCTGGTGCAGTTCCTGTGCAAGGAGAAACCTTTA[A/T]AGTATGCCTACATATTCTAGTATTATAGAGTGTTTGCCATTAATTGATGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: