
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
usp25
- Ensembl ID:
- ENSDARG00000012314
- ZFIN ID:
- ZDB-GENE-040426-2847
- Description:
- ubiquitin carboxyl-terminal hydrolase 25 [Source:RefSeq peptide;Acc:NP_001001886]
- Human Orthologue:
- USP25
- Human Description:
- ubiquitin specific peptidase 25 [Source:HGNC Symbol;Acc:12624]
- Mouse Orthologue:
- Usp25
- Mouse Description:
- ubiquitin specific peptidase 25 Gene [Source:MGI Symbol;Acc:MGI:1353655]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34963 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa16746 | Nonsense | Available for shipment | Available now |
sa21787 | Nonsense | Available for shipment | Available now |
sa41714 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11988 | Essential Splice Site | Available for shipment | Available now |
sa18443 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa34963
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115250 | Nonsense | 238 | 1073 | 7 | 24 |
- Genomic Location (Zv9):
- Chromosome 10 (position 39587071)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 38277042 GRCz11 10 38220800 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGAGCTTAGGCATCTCTTCTCCTTGTTGGTGGGCTCCAAGCGGAAGTA[T/A]GTGGACCCGTCCGGGGCCGTGGAGATCCTCAAAGATGCCTTCAAGTCCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16746
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115250 | Nonsense | 404 | 1073 | 12 | 24 |
- Genomic Location (Zv9):
- Chromosome 10 (position 39575539)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 38265510 GRCz11 10 38209268 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATACTTCCAGTTTTCAGAGAAGCCGCGTGTTGCWTGATTGATTTTNAGGTA[C/A]ATGGACAGGAACCGAGAGATCACACGGATAAAGCGAGAGGAGATCAGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21787
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115250 | Nonsense | 705 | 1073 | 17 | 24 |
- Genomic Location (Zv9):
- Chromosome 10 (position 39562530)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 38252501 GRCz11 10 38196259 - KASP Assay ID:
- 2260-3559.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTTTGTGGAGGCAGATAACAAGCTCTTCGAGAGGGAGATGGAGGAGTG[G/A]GATGCTTTACAGGCCCGCAAACTCCAGCAGGAAAAGTTGGCTCTGGCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41714
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115250 | Nonsense | 751 | 1073 | 18 | 24 |
- Genomic Location (Zv9):
- Chromosome 10 (position 39560730)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 38250701 GRCz11 10 38194459 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCTACAAAAACTCAATGAAGCTAATTCTCAGCTCCATCAGCAGCTCCT[C/T]AGCATGACCCAGAGTACATGGAGCAACAGTCGCCCAGCGGAGACTCCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11988
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115250 | Essential Splice Site | 908 | 1073 | 21 | 24 |
- Genomic Location (Zv9):
- Chromosome 10 (position 39544616)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 38234587 GRCz11 10 38178345 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGACGTCAGTGTTCCTGTTGATCGGCCTGGAATTATTYATGAAGAAAAG[G/A]TGAAGATCCATTTCTTGCATTTCAAGTTCACAGTTATGTATGCAAACAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18443
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115250 | Nonsense | 954 | 1073 | 23 | 24 |
- Genomic Location (Zv9):
- Chromosome 10 (position 39539675)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 38229646 GRCz11 10 38173404 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AYTGATYTTTCTGTGTTGTTTTCGTGTGTGCTGTAGAAGTTAAATGARTA[C/A]GCTGCCGCTTTGTTCGAGACKGGCGAGGAGGCTAAAGTGAACACGGGTCW
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Panic disorder: Genome-wide association study of panic disorder in the Japanese population. (View Study)
- Parkinson's disease: Web-based genome-wide association study identifies two novel loci and a substantial genetic component for Parkinson's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: