zgc:65851

Ensembl ID:
ENSDARG00000012281
ZFIN ID:
ZDB-GENE-030131-9669
Description:
internexin neuronal intermediate filament protein, alpha [Source:RefSeq peptide;Acc:NP_955828]
Human Orthologue:
INA
Human Description:
internexin neuronal intermediate filament protein, alpha [Source:HGNC Symbol;Acc:6057]
Mouse Orthologue:
Ina
Mouse Description:
internexin neuronal intermediate filament protein, alpha Gene [Source:MGI Symbol;Acc:MGI:96568]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40375 Essential Splice Site Mutation detected in F1 DNA During 2018
sa16183 Nonsense Available for shipment Available now
sa40374 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018351 Essential Splice Site 354 562 2 4
Genomic Location (Zv9):
Chromosome 5 (position 14881862)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13175720
GRCz11 5 13675937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGCAGAGATGGAGGACCGGCACAGCAACGAGATCGGAGAGCTGCAG[G/A]TCAGAAAAAGAGAGCAATCCATTATTTTAAACACATTTTACATTTAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018351 Nonsense 395 562 3 4
Genomic Location (Zv9):
Chromosome 5 (position 14878917)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13172775
GRCz11 5 13672992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGACCTGCTGAATGTCAAGATGGCSCTGGACATTGAGATCGCAGCATA[C/A]AGGTCAGACWCCTTCATTATTWTAATGACTATTGGCAACATAGGCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018351 Nonsense 439 562 4 4
Genomic Location (Zv9):
Chromosome 5 (position 14878336)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13172194
GRCz11 5 13672411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTCGCACGTATACCCTAAGCGCCTACAGGAGGGCTGGAGCCAAACCC[G/T]AAACAGAGGAAGAGGAAAAGCAGGAGGAGGAAGAGGAGGAAGAGGAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link