
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110154
- Ensembl ID:
- ENSDARG00000012274
- ZFIN ID:
- ZDB-GENE-050417-398
- Description:
- eukaryotic translation initiation factor 4E-like [Source:RefSeq peptide;Acc:NP_001017851]
- Human Orthologues:
- EIF4E, EIF4E1B
- Human Descriptions:
- eukaryotic translation initiation factor 4E family member 1B [Source:HGNC Symbol;Acc:33179]
- eukaryotic translation initiation factor 4E [Source:HGNC Symbol;Acc:3287]
- Mouse Orthologues:
- AC138218.1, Eif4e, Eif4e1b
- Mouse Descriptions:
- eukaryotic translation initiation factor 4E family member 1B Gene [Source:MGI Symbol;Acc:MGI:2685119
- eukaryotic translation initiation factor 4E Gene [Source:MGI Symbol;Acc:MGI:95305]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35452 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35452
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000036718 | Nonsense | 132 | 213 | 6 | 7 |
ENSDART00000132073 | Nonsense | 149 | 230 | 6 | 7 |
The following transcripts of ENSDARG00000012274 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 18370331)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 18190366 GRCz11 13 18321358 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCATTTCTGACTGTCCATGTGTCTGTCATCTTCTTTTGCAGCTGTTGTG[T/A]TTAATCGGAGAGTCCTTTGACGAGGCCAGTGAAGATGTGTGTGGTGCTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: