zgc:110154

Ensembl ID:
ENSDARG00000012274
ZFIN ID:
ZDB-GENE-050417-398
Description:
eukaryotic translation initiation factor 4E-like [Source:RefSeq peptide;Acc:NP_001017851]
Human Orthologues:
EIF4E, EIF4E1B
Human Descriptions:
eukaryotic translation initiation factor 4E family member 1B [Source:HGNC Symbol;Acc:33179]
eukaryotic translation initiation factor 4E [Source:HGNC Symbol;Acc:3287]
Mouse Orthologues:
AC138218.1, Eif4e, Eif4e1b
Mouse Descriptions:
eukaryotic translation initiation factor 4E family member 1B Gene [Source:MGI Symbol;Acc:MGI:2685119
eukaryotic translation initiation factor 4E Gene [Source:MGI Symbol;Acc:MGI:95305]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35452 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036718 Nonsense 132 213 6 7
ENSDART00000132073 Nonsense 149 230 6 7

The following transcripts of ENSDARG00000012274 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18370331)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18190366
GRCz11 13 18321358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATTTCTGACTGTCCATGTGTCTGTCATCTTCTTTTGCAGCTGTTGTG[T/A]TTAATCGGAGAGTCCTTTGACGAGGCCAGTGAAGATGTGTGTGGTGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link