zgc:63721

Ensembl ID:
ENSDARG00000012247
ZFIN ID:
ZDB-GENE-040426-1246
Description:
Differentially expressed in FDCP 6 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7SYB5]
Human Orthologue:
DEF6
Human Description:
differentially expressed in FDCP 6 homolog (mouse) [Source:HGNC Symbol;Acc:2760]
Mouse Orthologue:
Def6
Mouse Description:
differentially expressed in FDCP 6 Gene [Source:MGI Symbol;Acc:MGI:1346328]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34348 Nonsense Mutation detected in F1 DNA During 2018
sa41144 Nonsense Mutation detected in F1 DNA During 2018
sa18435 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005359 Nonsense 214 612 4 11
Genomic Location (Zv9):
Chromosome 8 (position 14716606)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14161950
GRCz11 8 14199655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCATGGCTATTGAGGAAGTGTATCGGGAAATAGTCGGTGATGTGCTG[A/T]AAGAGGTATTACGTTATTTGTTTGTATTCATATTTTTATTGATTTGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005359 Nonsense 285 612 6 11
Genomic Location (Zv9):
Chromosome 8 (position 14712544)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14157888
GRCz11 8 14195593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATGGGAAGAGGTGCATGTTCTGTCTGAAAACGCTCACCAAGACTTA[C/A]GAACTCAGCGCGTCAGACACCAAACAGAGGCAGGAGTGGACTACAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005359 Nonsense 438 612 8 11
Genomic Location (Zv9):
Chromosome 8 (position 14707745)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14153089
GRCz11 8 14190794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGTATCAGAGAACTGGAGGCCATGCAGCAGCGGCTAGAGGATGCGTTA[C/T]AGCAGGAAATCAAAGCAAGGCAGGACGAAGAAGCCTTCCGCTACGCACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link