
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ube2e3
- Ensembl ID:
- ENSDARG00000012244
- ZFIN ID:
- ZDB-GENE-030131-408
- Description:
- ubiquitin-conjugating enzyme E2 E3 [Source:RefSeq peptide;Acc:NP_957215]
- Human Orthologue:
- UBE2E3
- Human Description:
- ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) [Source:HGNC Symbol;Acc:12479]
- Mouse Orthologue:
- Ube2e3
- Mouse Description:
- ubiquitin-conjugating enzyme E2E 3, UBC4/5 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107412]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17991 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17991
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020550 | Essential Splice Site | None | 209 | 1 | 6 |
The following transcripts of ENSDARG00000012244 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 9 (position 44871292)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 43996462 GRCz11 9 43798249 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATTTTTAACACTCCTAACCACCCCAGTTCAGGACAGGACCGCRTCTAAG[G/A]TAAAGGAGAAGCTCTAAGGGTCTCGTAGAGTCCACKTTAGGCGGGGTAAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Celiac disease: Multiple common variants for celiac disease influencing immune gene expression. (View Study)
- Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: