zgc:65979

Ensembl ID:
ENSDARG00000012222
ZFIN ID:
ZDB-GENE-030131-9407
Description:
Nucleoporin NUP53 [Source:UniProtKB/Swiss-Prot;Acc:Q6P6X9]
Human Orthologue:
NUP35
Human Description:
nucleoporin 35kDa [Source:HGNC Symbol;Acc:29797]
Mouse Orthologues:
AC160535.1, Nup35
Mouse Descriptions:
nucleoporin 35 Gene [Source:MGI Symbol;Acc:MGI:1916732]
nucleoporin NUP53 isoform 1 [Source:RefSeq peptide;Acc:NP_081367]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21442 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032344 Nonsense 130 308 5 9
ENSDART00000131766   None 112 None 4
ENSDART00000136558 Nonsense 130 230 5 8
ENSDART00000144734 Nonsense 135 227 5 7
Genomic Location (Zv9):
Chromosome 9 (position 12542486)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12295051
GRCz11 9 12266254
KASP Assay ID:
2260-1564.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCTATTTTGTTCTATAGTTTCTAACTTTTTTAGTCCCGTGAGTCAG[C/T]AGAGGAAAACAACCCTTTCACCAGCTCAAGTAGATCCGTTCTTCACACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link