
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:65979
- Ensembl ID:
- ENSDARG00000012222
- ZFIN ID:
- ZDB-GENE-030131-9407
- Description:
- Nucleoporin NUP53 [Source:UniProtKB/Swiss-Prot;Acc:Q6P6X9]
- Human Orthologue:
- NUP35
- Human Description:
- nucleoporin 35kDa [Source:HGNC Symbol;Acc:29797]
- Mouse Orthologues:
- AC160535.1, Nup35
- Mouse Descriptions:
- nucleoporin 35 Gene [Source:MGI Symbol;Acc:MGI:1916732]
- nucleoporin NUP53 isoform 1 [Source:RefSeq peptide;Acc:NP_081367]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21442 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21442
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032344 | Nonsense | 130 | 308 | 5 | 9 |
ENSDART00000131766 | None | 112 | None | 4 | |
ENSDART00000136558 | Nonsense | 130 | 230 | 5 | 8 |
ENSDART00000144734 | Nonsense | 135 | 227 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 9 (position 12542486)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 12295051 GRCz11 9 12266254 - KASP Assay ID:
- 2260-1564.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATGCTATTTTGTTCTATAGTTTCTAACTTTTTTAGTCCCGTGAGTCAG[C/T]AGAGGAAAACAACCCTTTCACCAGCTCAAGTAGATCCGTTCTTCACACAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: