zgc:162872

Ensembl ID:
ENSDARG00000012184
ZFIN ID:
ZDB-GENE-081022-1
Description:
hypothetical protein LOC100004931 [Source:RefSeq peptide;Acc:NP_001091664]
Human Orthologues:
ACAP1, ACAP2, ACAP3
Human Descriptions:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 [Source:HGNC Symbol;Acc:16467]
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 [Source:HGNC Symbol;Acc:16469]
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 [Source:HGNC Symbol;Acc:16754]
Mouse Orthologues:
Acap1, Acap2, Acap3
Mouse Descriptions:
ArfGAP with coiled-coil, ankyrin repeat and PH domains 1 Gene [Source:MGI Symbol;Acc:MGI:2388270]
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 Gene [Source:MGI Symbol;Acc:MGI:1925868]
ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 Gene [Source:MGI Symbol;Acc:MGI:2153589]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2785 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2785
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085926 Nonsense 453 600 15 19
Genomic Location (Zv9):
Chromosome 15 (position 46031815)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46453748
GRCz11 15 46687965
KASP Assay ID:
554-2499.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTCCAAAGTTCGTTCGCTCACTCTTGATTCCTGGGAGCCWGAACAGT[T/G]AAAGGTTTCATATGTTCTCTATATCTTTCAATAYATATGGTTTATTGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link