zgc:101015

Ensembl ID:
ENSDARG00000012177
ZFIN ID:
ZDB-GENE-040822-15
Description:
Ras-related protein Rab-4B [Source:UniProtKB/Swiss-Prot;Acc:Q68EK7]
Human Orthologue:
RAB4B
Human Description:
RAB4B, member RAS oncogene family [Source:HGNC Symbol;Acc:9782]
Mouse Orthologue:
Rab4b
Mouse Description:
RAB4B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105071]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30988 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42493 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35811 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008273 Essential Splice Site 6 213 None 8
ENSDART00000008273 Essential Splice Site 6 213 None 8

The following transcripts of ENSDARG00000012177 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 8991518)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8880131
GRCz11 15 8856202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCGGTCGATTGGTTTCATCGGTGGGACCGACATGTCAGAGACGTACGG[T/C]AATGACATTTTTTGTTGTGGTTAGCACTTACAGTTAGCTAGTGCTGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008273 Essential Splice Site 6 213 None 8
ENSDART00000008273 Essential Splice Site 6 213 None 8

The following transcripts of ENSDARG00000012177 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 8991518)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8880131
GRCz11 15 8856202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCGGTCGATTGGTTTCATCGGTGGGACCGACATGTCAGAGACGTACGG[T/C]AATGACATTTTTTGTTGTGGTTAGCACTTACAGTTAGCTAGTGCTGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008273 Essential Splice Site 71 213 3 8

The following transcripts of ENSDARG00000012177 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 8969886)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8858499
GRCz11 15 8834570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGTCAAACTGCAGATCTGGGACACGGCTGGACAGGAGCGCTTTAGG[T/C]ACTCGCCTGTGATTGGTTGATTTGGAACTGCTCACTGTTAAAGGCGGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link