ccnl1

Ensembl ID:
ENSDARG00000012140
ZFIN ID:
ZDB-GENE-030131-4813
Description:
Cyclin-L1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVX0]
Human Orthologue:
CCNL1
Human Description:
cyclin L1 [Source:HGNC Symbol;Acc:20569]
Mouse Orthologue:
Ccnl1
Mouse Description:
cyclin L1 Gene [Source:MGI Symbol;Acc:MGI:1922664]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45110 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004899 Essential Splice Site 182 498 4 11

The following transcripts of ENSDARG00000012140 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 36392550)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36689260
GRCz11 2 36671717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCCTGAAGGAGCTGGGCTTCTGTGTTCATGTCAAACATCCACATAAG[G/A]TGAGTTTTGTTTACTATCAGTTAAAATGTTGTTATTGCTTGTCTTCTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link