zgc:109965

Ensembl ID:
ENSDARG00000012126
ZFIN ID:
ZDB-GENE-050913-21
Description:
hypothetical protein LOC619266 [Source:RefSeq peptide;Acc:NP_001028919]
Human Orthologue:
NCLN
Human Description:
nicalin [Source:HGNC Symbol;Acc:26923]
Mouse Orthologue:
Ncln
Mouse Description:
nicalin homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1926081]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14336 Nonsense Available for shipment Available now
sa43596 Nonsense Mutation detected in F1 DNA During 2018
sa37253 Nonsense Available for shipment Available now
sa39319 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43595 Nonsense Mutation detected in F1 DNA During 2018
sa14355 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044504 Nonsense 69 590 2 16
ENSDART00000122705 Nonsense 87 608 2 16
Genomic Location (Zv9):
Chromosome 21 (position 11285926)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 12987291
GRCz11 21 13084279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCAGTGCATCTCCTGCATGCGTCTGCTCTTCCTGCTGYGTCTTCATA[T/G]GAGTTYAACGCCTACAGGATGCAGCACTACAACCTACATCAACACAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044504 Nonsense 261 590 7 16
ENSDART00000122705 Nonsense 279 608 7 16
Genomic Location (Zv9):
Chromosome 21 (position 11277613)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 12978978
GRCz11 21 13075966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGCCGACCGTGTTTTGACATGGTAAATGTGTTTTAGTGGCTGGCGTA[T/A]GGTGCAGACTCTAATGGCAGCGGTGTCGCTATTCTTCTCGAGTTGGTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044504 Nonsense 452 590 11 16
ENSDART00000122705 Nonsense 470 608 11 16
Genomic Location (Zv9):
Chromosome 21 (position 11271890)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 12973255
GRCz11 21 13070243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAGCGGAACACAGTTATTGTTGCTGAGTCCTTGGCAAGATTCATGTA[C/A]AATCTTTCAGACAAGGTGAGGAAAAGAGTGTGTCGTCACATTAAAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39319
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044504 Essential Splice Site 457 590 11 16
ENSDART00000122705 Essential Splice Site 475 608 11 16
Genomic Location (Zv9):
Chromosome 21 (position 11271874)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 12973239
GRCz11 21 13070227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGTTGCTGAGTCCTTGGCAAGATTCATGTACAATCTTTCAGACAAG[G/T]TGAGGAAAAGAGTGTGTCGTCACATTAAAATGTTCACGCCAACCTTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43595
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044504 Nonsense 545 590 14 16
ENSDART00000122705 Nonsense 563 608 14 16
Genomic Location (Zv9):
Chromosome 21 (position 11270478)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 12971843
GRCz11 21 13068831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCTGAAATCACTTTCTTCGATCAAATGAAGCAACCAATGATGATGTA[C/A]AGGTGAGTAAGCCTTCTGATTGATTGTTTTAGGGTGCTTTCACACCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14355
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044504 Essential Splice Site 573 590 None 16
ENSDART00000122705 Essential Splice Site 591 608 None 16
Genomic Location (Zv9):
Chromosome 21 (position 11268598)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 12969963
GRCz11 21 13066951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AMGTTTATACAGTTTTTTGGTWTATWTGTTAATSGTTGCTTGTTGGTTGC[A/T]GAACTTTGGGMACGTCTACACGAAACTGAAAGCAWCCATGAAAGCCAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link