kif15

Ensembl ID:
ENSDARG00000012073
ZFIN ID:
ZDB-GENE-050622-16
Description:
Wu:fc51g12 protein [Source:UniProtKB/TrEMBL;Acc:A0JPF4]
Human Orthologue:
KIF15
Human Description:
kinesin family member 15 [Source:HGNC Symbol;Acc:17273]
Mouse Orthologue:
Kif15
Mouse Description:
kinesin family member 15 Gene [Source:MGI Symbol;Acc:MGI:1098258]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45858 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa38135 Nonsense Mutation detected in F1 DNA During 2018
sa10447 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099866 Nonsense 749 1378 18 35
ENSDART00000099868 Nonsense 749 1010 18 25
ENSDART00000130782 Splice Site None 1372 None 34

The following transcripts of ENSDARG00000012073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 36143704)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34577972
GRCz11 25 35082930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGCCAAGAACAGAAAACTACTTCAGCAAATGAGCAAGCTGGAAGAA[C/T]AGGTTACCATCGCAACTGAAAAGTCTAATCGCACAGAACAGGTGTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099866 Nonsense 895 1378 21 35
ENSDART00000099868 Nonsense 895 1010 21 25
ENSDART00000130782 Nonsense 877 1372 20 34

The following transcripts of ENSDARG00000012073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 36139954)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34574222
GRCz11 25 35079180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGAGCTGGATCAGCACACACAGCAGATGGAGCTCAAGAGCAGAGAGTG[T/A]TCACAACTTCAAACCAACATCAACGTCAGTATTCATTCACACACACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099866 Nonsense 1034 1378 26 35
ENSDART00000099868   None 1010 None 25
ENSDART00000130782 Nonsense 1016 1372 25 34

The following transcripts of ENSDARG00000012073 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 36135409)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34569677
GRCz11 25 35074635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAKGGYTTTCTGTGCAGGGAAAGTACAGCGCAGTGTGTGCWGAGAAGGAG[C/T]AGATGAAGGAGAGCATCACACGMATGAAAAGTGAACTGCAGGAGCTGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link